, Pluripotency Markers Flow cytometry Oct-4A Rabbit mAb (Clone C30A3) IgG, vol.1, p.200
, RRID:AB_2167691 Pluripotency Markers Flow cytometry Sox2 XP® Rabbit mAb (Clone D6D9) IgG, vol.2840, p.200
, RRID:AB_2195767 Pluripotency Markers Flow cytometry Nanog XP® Rabbit mAb (Clone D73G4) IgG, vol.3579, p.200
, RRID:AB_10559205 Pluripotency Markers Flow cytometry SSEA4 Mouse mAb (Clone MC813) IgG3, vol.4903, p.200
, RRID:AB_1264259 Pluripotency Markers Flow, vol.4755, p.200
, RRID:AB_2119059 Pluripotency Markers Flow cytometry TRA-1-81 Mouse mAb (Clone TRA-1-81) IgM, vol.4746, p.200
, RRID:AB_1645308 Pluripotency Markers Immunostaining Alexa FluorR 647 Mouse anti-SSEA-4 (Clone : MC813-70) 1:5 BD Biosciences Cat# 560796, RRID:AB_2033991 Pluripotency Markers Immunostaining PE Mouse IgG1, ? Isotype Control (Clone MOPC-21) 1:5 BD Biosciences Cat# 554121, RRID:AB_395252 Pluripotency Markers Immunostaining PerCP-Cy5.5 Mouse IgG1, ? Isotype Control, vol.4745, p.396989
, Pluripotency Markers Immunostaining Secondary Antibody Alexa Fluor® 488 conjugate Goat anti-Rabbit IgG 1:400 Invitrogen-Thermo Fisher Scientific Cat# A-11034, RRID:AB_2576217 Pluripotency Markers Immunostaining Secondary Antibody Alexa Fluor® 555 conjugate Goat anti-Rabbit IgG 1:400 Invitrogen-Thermo Fisher Scientific Cat# A-21424
, Bloom mutation (Sanger sequencing) Bloom mutation 5?TGGCACCAGGGACAATATGC3'/5?ACTGCAAATTTAACTGCTGTGCT3'
, Cell Research, vol.43, p.101696, 2020.
Bloom's syndrome: clinical spectrum, molecular pathogenesis, and cancer predisposition, Mol. Syndromol. Janv, vol.8, issue.1, pp.4-23, 2017. ,
Chromatin structure and gene expression programs of human embryonic and induced pluripotent stem cells, Cell Stem Cell, vol.7, issue.2, pp.249-257, 2015. ,
Rejuvenating senescent and centenarian human cells by reprogramming through the pluripotent state, Genes Dev, vol.25, issue.21, pp.2248-2253, 2011. ,
Reprogramming of Human Peripheral Blood Mononuclear Cell (PBMC) from a patient suffering of a Werner syndrome resulting in iPSC line (REGUi003-A) maintaining a short telomere length, Stem Cell Res, vol.39, pp.101515-101516, 2019. ,
URL : https://hal.archives-ouvertes.fr/hal-02505693