, RRID:AB_2195767 Pluripotency markers flow cytometry Nanog XP® Rabbit mAb (Clone D73G4) IgG 1:200 Cell signaling technology cat# 4903, RRID:AB_10559205 Pluripotency markers flow cytometry SSEA4 Mouse mAb (Clone MC813) IgG3 1:200 Cell signaling technology cat# 4755, RRID:AB_1264259 Pluripotency markers flow cytometry, vol.1, p.200
, RRID:AB_2119059 Pluripotency markers flow cytometry TRA-1-81 Mouse mAb (Clone TRA-1-81) IgM 1:200 Cell signaling technology cat# 4745, RRID:AB_2119060 Pluripotency markers immunostaining PE Mouse anti-human Nanog (Clone: N31-355) 1:5 BD Biosciences Cat#, vol.4746, p.1937305
, Pluripotency Markers Immunostaining PerCP-CyTM 5.5 Mouse anti-Oct3/4 (Clone: 40/Oct-3) 1:5 BD Biosciences Cat#, vol.560794, p.1937313
, RRID:AB_1645308 Pluripotency markers immunostaining Alexa FluorR 647 Mouse anti-SSEA-4 (Clone: MC813-70) 1:5 BD Biosciences Cat# 560796, RRID:AB_2033991 Pluripotency markers immunostaining PE Mouse IgG1, ? Isotype Control (Clone MOPC-21) 1:5 BD Biosciences Cat# 554121, RRID:AB_395252 Pluripotency markers immunostaining PerCP-Cy5.5 Mouse IgG1, ? Isotype Control, vol.560301, p.396989
, Pluripotency markers immunostaining Secondary Antibody Alexa Fluor® 488 conjugate Goat anti-Rabbit IgG 1:400 Invitrogen-thermo fisher scientific cat# A-11034
, Pluripotency markers immunostaining Secondary Antibody Alexa Fluor® 555 conjugate Goat anti-Rabbit IgG 1:400 Invitrogen-thermo fisher scientific cat# A-21424
, Primers Target Forward/Reverse primer, pp.5-8
, Werner mutation (Sanger sequencage) WERNER mutation 5'TGAGCTCCCCATAAAAAGGGAA3'/ 5'TGGCCAAACTAAACTTGCTGC3'
, Cell Research, vol.39, p.101515, 2019.
Chromatin structure and gene expression programs of human embryonic and induced pluripotent stem cells, Cell Stem Cell, vol.7, issue.2, pp.249-257, 2015. ,
Rejuvenating senescent and centenarian human cells by reprogramming through the pluripotent state, Genes Dev, vol.25, issue.21, pp.2248-2253, 2011. ,
Werner syndrome and mutations of the WRN and LMNA genes in France, Hum. Mutat. Jul, vol.27, issue.7, pp.718-719, 2006. ,
Spontaneous reversal of the developmental aging of normal human cells following transcriptional reprogramming, Regen. Med, vol.5, pp.345-363, 2010. ,