, RRID:AB_2195767 Pluripotency markers flow cytometry Nanog XP® Rabbit mAb (Clone D73G4) IgG 1:200 Cell signaling technology cat# 4903, RRID:AB_10559205 Pluripotency markers flow cytometry SSEA4 Mouse mAb (Clone MC813) IgG3 1:200 Cell signaling technology cat# 4755, RRID:AB_1264259 Pluripotency markers flow cytometry, vol.1, p.200

, RRID:AB_2119059 Pluripotency markers flow cytometry TRA-1-81 Mouse mAb (Clone TRA-1-81) IgM 1:200 Cell signaling technology cat# 4745, RRID:AB_2119060 Pluripotency markers immunostaining PE Mouse anti-human Nanog (Clone: N31-355) 1:5 BD Biosciences Cat#, vol.4746, p.1937305

, Pluripotency Markers Immunostaining PerCP-CyTM 5.5 Mouse anti-Oct3/4 (Clone: 40/Oct-3) 1:5 BD Biosciences Cat#, vol.560794, p.1937313

, RRID:AB_1645308 Pluripotency markers immunostaining Alexa FluorR 647 Mouse anti-SSEA-4 (Clone: MC813-70) 1:5 BD Biosciences Cat# 560796, RRID:AB_2033991 Pluripotency markers immunostaining PE Mouse IgG1, ? Isotype Control (Clone MOPC-21) 1:5 BD Biosciences Cat# 554121, RRID:AB_395252 Pluripotency markers immunostaining PerCP-Cy5.5 Mouse IgG1, ? Isotype Control, vol.560301, p.396989

, Pluripotency markers immunostaining Secondary Antibody Alexa Fluor® 488 conjugate Goat anti-Rabbit IgG 1:400 Invitrogen-thermo fisher scientific cat# A-11034

, Pluripotency markers immunostaining Secondary Antibody Alexa Fluor® 555 conjugate Goat anti-Rabbit IgG 1:400 Invitrogen-thermo fisher scientific cat# A-21424

, Primers Target Forward/Reverse primer, pp.5-8

, Werner mutation (Sanger sequencage) WERNER mutation 5'TGAGCTCCCCATAAAAAGGGAA3'/ 5'TGGCCAAACTAAACTTGCTGC3'

V. Gatinois, Cell Research, vol.39, p.101515, 2019.

M. G. Guenther, G. M. Frampton, F. Soldner, D. Hockemeyer, M. Mitalipova et al., Chromatin structure and gene expression programs of human embryonic and induced pluripotent stem cells, Cell Stem Cell, vol.7, issue.2, pp.249-257, 2015.

L. Lapasset, O. Milhavet, A. Prieur, E. Besnard, A. Babled et al., Rejuvenating senescent and centenarian human cells by reprogramming through the pluripotent state, Genes Dev, vol.25, issue.21, pp.2248-2253, 2011.

N. A. Uhrhammer, L. Lafarge, L. Santos, A. Domaszewska, M. Lange et al., Werner syndrome and mutations of the WRN and LMNA genes in France, Hum. Mutat. Jul, vol.27, issue.7, pp.718-719, 2006.

H. Vaziri, K. B. Chapman, A. Guigova, J. Teichroeb, M. D. Lacher et al., Spontaneous reversal of the developmental aging of normal human cells following transcriptional reprogramming, Regen. Med, vol.5, pp.345-363, 2010.